Journal of Alzheimer's Disease - Volume 93, issue 1

Authors: Brenner, Einat K. | Weigand, Alexandra J. | Edwards, Lauren | Thomas, Kelsey R. | Edmonds, Emily C. | Bondi, Mark W. | Bangen, Katherine J.

Article Type: Research Article

Abstract: Background: Brain-derived neurotrophic factor (BDNF) is a neurotrophin that plays an important role in regulating synaptic activity and plasticity. Objective: Given that type-2 diabetes (T2DM) increases the risk of cognitive decline, and studies have suggested lower BDNF levels may be a risk factor of diabetic neurovascular complications, we sought to investigate total white matter hyperintensities (WMH) as a moderator of the effect of BDNF on hippocampal volume and cognition. Methods: Older adults without dementia from the Alzheimer’s Disease Neuroimaging Initiative (N = 454 including 49 with T2DM and 405 without diabetes) underwent neuropsychological evaluation, magnetic resonance imaging to …quantify hippocampal and WMH volumes, and blood draw to assess BDNF. Results: Adjusting for age, sex, and APOE ɛ4 carrier status, there was a significant interaction between total WMH and BDNF on bilateral hippocampal volume in the non-T2DM group (t  = 2.63, p  = 0.009). Examination of main effect models with a dichotomous high/low BNDF group revealed a significant main effect for low BDNF (t  = –4.98, p  < 0.001), such that as WMH increased, bilateral hippocampal volume decreased. There was also a significant interaction between total WMH and BDNF on processing speed in the non-T2DM group (t  = 2.91, p  = 0.004). There was a significant main effect for low BDNF (t  = –3.55, p  < 0.001) such that as WMH increased, processing speed decreased. The interactions were not significant in the T2DM group. Conclusion: These results further elucidate the protective role that BDNF plays on cognition, as well as the cognitive effects of WMH. Show more

Keywords: Alzheimer’s disease, brain-derived neurotrophic factor, hippocampal volume, neuropsychology, type-2 diabetes, white matter hyperintensities

DOI: 10.3233/JAD-221178

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 141-149, 2023

Authors: Rodrigues Martins, Dina | Vandermeeren, Marc | Van Kolen, Kristof | Brepoels, Eddy | Borgers, Marianne | Wintmolders, Cindy | Delay, Charlotte | Bottelbergs, Astrid | Mercken, Marc | Theunis, Clara

Article Type: Research Article

Abstract: Background: Clearance of tau seeds by immunization with tau antibodies is currently evaluated as therapeutic strategy to block the spreading of tau pathology in Alzheimer’s disease and other tauopathies. Preclinical evaluation of passive immunotherapy is performed in different cellular culture systems and in wild-type and human tau transgenic mouse models. Depending on the preclinical model used, tau seeds or induced aggregates can either be of mouse, human or mixed origin. Objective: We aimed to develop human and mouse tau-specific antibodies to discriminate between the endogenous tau and the introduced form in preclinical models. Methods: Using hybridoma …technology, we developed human and mouse tau-specific antibodies that were then used to develop several assays to specifically detect mouse tau. Results: Four antibodies, mTau3, mTau5, mTau8, and mTau9, with a high degree of specificity for mouse tau were identified. Additionally, their potential application in highly sensitive immunoassays to measure tau in mouse brain homogenate and cerebrospinal fluid is illustrated, as well as their application for specific endogenous mouse tau aggregation detection. Conclusion: The antibodies reported here can be very important tools to better interpret the results obtained from different model systems as well as to study the role of endogenous tau in tau aggregation and pathology observed in the diverse mouse models available. Show more

Keywords: Antibodies, assay development, cerebrospinal fluid, murine tau, tau aggregation

DOI: 10.3233/JAD-221266

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 151-167, 2023

Authors: Gao, Yang | Liu, Yanchao | Zhang, Yao | Wang, Yuying | Zheng, Jie | Xu, Zhipeng | Yu, Haitao | Jin, Zetao | Yin, Yin | He, Benrong | Sun, Fei | Xiong, Rui | Lei, Huiyang | Jiang, Tao | Liang, Yi | Ke, Dan | Zhao, Shi | Mo, Wen | Li, Yanni | Zhou, Qiuzhi | Wang, Xin | Zheng, Chenghong | Zhang, Huaqiu | Liu, Gongping | Yang, Ying | Wang, Jian-Zhi

Article Type: Research Article

Abstract: Background: Olfactory dysfunction appears prior to cognitive decline, and thus it has been suggested to be an early predictor of Alzheimer’s disease. However, it is currently not known whether and how olfactory threshold test could serve as a quick screening tool for cognitive impairment. Objective: To define olfactory threshold test for screening cognitive impairment in two independent cohorts. Methods: The participants are comprised of two cohorts in China, 1,139 inpatients with type 2 diabetes mellitus (T2DM, Discovery cohort) and 1,236 community-dwelling elderly (Validation cohort). Olfactory and cognitive functions were evaluated by Connecticut Chemosensory Clinical Research Center …test and Mini-Mental State Examination (MMSE), respectively. Regression analyses and receiver operating characteristic (ROC) analyses were carried out to determine the relation and discriminative performance of the olfactory threshold score (OTS) regarding identification of cognition impairment. Results: Regression analysis showed that olfactory deficit (reducing OTS) was correlated with cognitive impairment (reducing MMSE score) in two cohorts. ROC analysis revealed that the OTS could distinguish cognitive impairment from cognitively normal individuals, with mean area under the curve values of 0.71 (0.67, 0.74) and 0.63 (0.60, 0.66), respectively, but it failed to discriminate dementia from mild cognitive impairment. The cut-off point of 3 showed the highest validity for the screening, with the diagnostic accuracy of 73.3% and 69.5%. Conclusion: Reducing OTS is associated with cognitive impairment in T2DM patients and the community-dwelling elderly. Therefore, olfactory threshold test may be used as a readily accessible screening tool for cognitive impairment. Show more

Keywords: Cut-off value, mild cognitive impairment, olfactory function, type 2 diabetes mellitus

DOI: 10.3233/JAD-230023

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 169-178, 2023

Authors: Turcotte, Valérie | Hudon, Carol | Potvin, Olivier | Dadar, Mahsa | Duchesne, Simon

Article Type: Research Article

Abstract: Background: Slowed rates of cognitive decline have been reported in individuals with higher cognitive reserve (CR), but interindividual discrepancies remain unexplained. Few studies have reported a birth cohort effect, favoring later-born individuals, but these studies remain scarce. Objective: We aimed to predict cognitive decline in older adults using birth cohorts and CR. Methods: Within the Alzheimer’s Disease Neuroimaging Initiative, 1,041 dementia-free participants were assessed on four cognitive domains (verbal episodic memory; language and semantic memory; attention; executive functions) at each follow-up visit up to 14 years. Four birth cohorts were formed according to the major historical …events of the 20th century (1916–1928; 1929–1938; 1939–1945; 1946–1962). CR was operationalized by merging education, complexity of occupation, and verbal IQ. We used linear mixed-effect models to evaluate the effects of CR and birth cohorts on rate of performance change over time. Age at baseline, baseline structural brain health (total brain and total white matter hyperintensities volumes), and baseline vascular risk factors burden were used as covariates. Results: CR was only associated with slower decline in verbal episodic memory. However, more recent birth cohorts predicted slower annual cognitive decline in all domains, except for executive functions. This effect increased as the birth cohort became more recent. Conclusion: We found that both CR and birth cohorts influence future cognitive decline, which has strong public policy implications. Show more

Keywords: Aging, birth cohorts, cognitive decline, cognitive reserve, generations, neuropsychology

DOI: 10.3233/JAD-220951

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 179-191, 2023

Authors: Franz, Carol E. | Gustavson, Daniel E. | Elman, Jeremy A. | Fennema-Notestine, Christine | Hagler Jr., Donald J. | Baraff, Aaron | Tu, Xin M. | Wu, Tsung-Chin | De Anda, Jaden | Beck, Asad | Kaufman, Joel D. | Whitsel, Nathan | Finch, Caleb E. | Chen, Jiu-Chiuan | Lyons, Michael J. | Kremen, William S.

Article Type: Research Article

Abstract: Background: Fine particulate matter (PM2.5 ) and nitrogen dioxide (NO2 ) measures of ambient air pollution are associated with accelerated age-related cognitive impairment, and Alzheimer’s disease and related dementias (ADRD). Objective: We examined associations between air pollution, four cognitive factors, and the moderating role of apolipoprotein E (APOE) genotype in the understudied period of midlife. Methods: Participants were ∼1,100 men in the Vietnam Era Twin Study of Aging. Baseline cognitive assessments were from 2003 to 2007. Measures included past (1993–1999) and recent (3 years prior to baseline assessment) PM2.5 and NO2 exposure, in-person …assessment of episodic memory, executive function, verbal fluency, and processing speed, and APOE genotype. Average baseline age was 56 years with a 12-year follow-up. Analyses adjusted for health and lifestyle covariates. Results: Performance in all cognitive domains declined from age 56 to 68. Higher PM2.5 exposures were associated with worse general verbal fluency. We found significant exposure-by-APOE genotype interactions for specific cognitive domains: PM2.5 with executive function and NO2 with episodic memory. Higher PM2.5 exposure was related to worse executive function in APOE ɛ4 carriers, but not in non-carriers. There were no associations with processing speed. Conclusion: These results indicate negative effects of ambient air pollution exposure on fluency alongside intriguing differential modifications of cognitive performance by APOE genotype. APOE ɛ4 carriers appeared more sensitive to environmental differences. The process by which air pollution and its interaction with genetic risk for ADRD affects risk for later life cognitive decline or progression to dementia may begin in midlife. Show more

Keywords: Aging, air pollution, APOE genotype, cognition, midlife, nitrogen dioxide, PM2.5

DOI: 10.3233/JAD-221054

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 193-209, 2023

Authors: Lanooij, Suzanne D. | Eisel, Ulrich L.M. | van der Zee, Eddy A. | Kas, Martien J.H.

Article Type: Research Article

Abstract: Background: Altered social behavior is one of the symptoms of Alzheimer’s disease (AD) that results in social withdrawal and loneliness and provides a major burden on patients and their relatives. Furthermore, loneliness is associated with an increased risk to develop AD and related dementias. Objective: We aimed to investigate if altered social behavior is an early indicator of amyloid-β (Aβ) pathology in J20 mice, and if co-housing with wild type (WT) mice can positively influence this social phenotype. Methods: The social phenotype of group-housed mice was assessed using an automated behavioral scoring system for longitudinal recordings. …Female mice were housed in a same-genotype (4 J20 or WT mice per colony) or mixed-genotype (2 J20 mice + 2 WT mice) colony. At 10 weeks of age, their behavior was assessed for five consecutive days. Results: J20 mice showed increased locomotor activity and social sniffing, and reduced social contact compared to WT mice housed in same-genotype colonies. Mixed-genotype housing reduced the social sniffing duration of J20 mice, increased social contact frequency of J20 mice, and increased nest hide by WT mice. Conclusion: Thus, altered social behavior can be used as an early indicator of Aβ-pathology in female J20 mice. Additionally, when co-housed with WT mice, their social sniffing phenotype is not expressed and their social contact phenotype is reduced. Our findings highlight the presence of a social phenotype in the early stages of AD and indicate a role for social environment variation in the expression of social behavior of WT and J20 mice. Show more

Keywords: Alzheimer’s disease, amyloid, gene-environment interaction, mice, social behavior, social environment

DOI: 10.3233/JAD-221126

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 211-224, 2023

Authors: Chu, Min | Nan, Haitian | Jiang, Deming | Liu, Li | Huang, Anqi | Wang, Yihao | Wu, Liyong

Article Type: Research Article

Abstract: Background: Progranulin (GRN ) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. Objective: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. Methods: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. Results: Neuroimaging revealed marked lateral atrophy and hypometabolism …in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient’s genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients – mostly female – with GRN mutations; the prevalence was 1.2% –2.6% and patients mostly had early disease onset. Conclusion: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD. Show more

Keywords: China, frontotemporal dementia, genetics, Progranulin (GRN)

DOI: 10.3233/JAD-230052

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 225-234, 2023

Authors: Ziyad, Shabana R. | Alharbi, Meshal | Altulyan, May

Article Type: Research Article

Abstract: Background: Alzheimer’s disease (AD) is a neurodegenerative disease that drastically affects brain cells. Early detection of this disease can reduce the brain cell damage rate and improve the prognosis of the patient to a great extent. The patients affected with AD tend to depend on their children and relatives for their daily chores. Objective: This research study utilizes the latest technologies of artificial intelligence and computation power to aid the medical industry. The study aims at early detection of AD to enable doctors to treat patients with the appropriate medication in the early stages of the …disease condition. Methods: In this research study, convolutional neural networks, an advanced deep learning technique, are adopted to classify AD patients with their MRI images. Deep learning models with customized architecture are precise in the early detection of diseases with images retrieved by neuroimaging techniques. Results: The convolution neural network model classifies the patients as diagnosed with AD or cognitively normal. Standard metrics evaluate the model performance to compare with the state-of-the-art methodologies. The experimental study of the proposed model shows promising results with an accuracy of 97%, precision of 94%, recall rate of 94%, and f1-score of 94%. Conclusion: This study leverages powerful technologies like deep learning to aid medical practitioners in diagnosing AD. It is crucial to detect AD early to control and slow down the rate at which the disease progresses. Show more

Keywords: Alzheimer’s disease, artificial intelligence system, cognitive normal, convolution neural network

DOI: 10.3233/JAD-221250

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 235-245, 2023

Authors: Parka, Aleksandra | Volbracht, Christiane | Hall, Benjamin | Bastlund, Jesper F. | Nedergaard, Maiken | Laursen, Bettina | Botta, Paolo | Sotty, Florence

Article Type: Research Article

Abstract: Background: Tauopathies such as Alzheimer’s disease (AD) and frontotemporal dementia (FTD) are characterized by formation of neurofibrillary tangles consisting of hyperphosphorylated tau protein. Early pathophysiological and functional changes related to neurofibrillary tangles formation are considered to occur prior to extensive neurodegeneration. Hyperphosphorylated tau has been detected in postmortem retinas of AD and FTD patients, and the visual pathway is an easily accessible system in a clinical setting. Hence, assessment of the visual function may offer the potential to detect consequences of early tau pathology in patients. Objective: The aim of this study was to evaluate visual function in …a tauopathy mouse model in relation to tau hyperphosphorylation and neurodegeneration. Methods: In this study we explored the association between the visual system and functional consequences of tau pathology progression using a tauopathy rTg4510 mouse model. To this end, we recorded full-field electroretinography and visual evoked potentials in anesthetized and awake states at different ages. Results: While retinal function remained mostly intact within all the age groups investigated, we detected significant changes in amplitudes of visual evoked potential responses in young rTg4510 mice exhibiting early tau pathology prior to neurodegeneration. These functional alterations in the visual cortex were positively correlated with pathological tau levels. Conclusion: Our findings suggest that visual processing could be useful as a novel electrophysiological biomarker for early stages of tauopathy. Show more

Keywords: Alzheimer’s disease, electroretinography, frontotemporal dementia, rTg4510, tauopathies, visual evoked potentials

DOI: 10.3233/JAD-220964

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 247-262, 2023

Authors: Rahmani, Farzaneh | Ghezzi, Laura | Tosti, Valeria | Liu, Jingxia | Song, Sheng-Kwei | Wu, Anthony T. | Rajamanickam, Jayashree | Obert, Kathleen A. | Benzinger, Tammie L.S. | Mittendorfer, Bettina | Piccio, Laura | Raji, Cyrus A.

Article Type: Research Article

Abstract: Background: Multiple sclerosis (MS) is a prototype neuroinflammatory disorder with increasingly recognized role for neurodegeneration. Most first-line treatments cannot prevent the progression of neurodegeneration and the resultant disability. Interventions can improve symptoms of MS and might provide insights into the underlying pathology. Objective: To investigate the effect of intermittent caloric restriction on neuroimaging markers of MS. Methods: We randomized ten participants with relapsing remitting MS to either a 12-week intermittent calorie restriction (iCR) diet (n  = 5) or control (n  = 5). Cortical thickness and volumes were measured through FreeSurfer, cortical perfusion was measured by arterial spin labeling …and neuroinflammation through diffusion basis spectrum imaging. Results: After 12 weeks of iCR, brain volume increased in the left superior and inferior parietal gyri (p: 0.050 and 0.049, respectively) and the banks of the superior temporal sulcus (p: 0.01). Similarly in the iCR group, cortical thickness improved in the bilateral medial orbitofrontal gyri (p: 0.04 and 0.05 in right and left, respectively), the left superior temporal gyrus (p: 0.03), and the frontal pole (p: 0.008) among others. Cerebral perfusion decreased in the bilateral fusiform gyri (p: 0.047 and 0.02 in right and left, respectively) and increased in the bilateral deep anterior white matter (p: 0.03 and 0.013 in right and left, respectively). Neuroinflammation, demonstrated through hindered and restricted water fractions (HF and RF), decreased in the left optic tract (HF p: 0.02), and the right extreme capsule (RF p: 0.007 and HF p: 0.003). Conclusion: These pilot data suggest therapeutic effects of iCR in improving cortical volume and thickness and mitigating neuroinflammation in midlife adults with MS. Show more

Keywords: Alzheimer’s disease, arterial spin labeling, caloric restriction, diffusion basis spectrum imaging, multiple sclerosis, neuroinflammation, prevention, relative cerebral blood flow

DOI: 10.3233/JAD-221007

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 263-273, 2023