You are viewing a javascript disabled version of the site. Please enable Javascript for this site to function properly.
Go to headerGo to navigationGo to searchGo to contentsGo to footer
In content section. Select this link to jump to navigation

The Rhythmicity of Clock Genes is Disrupted in the Choroid Plexus of the APP/PS1 Mouse Model of Alzheimer’s Disease

Abstract

Background:

The choroid plexus (CP), which constitutes the blood-cerebrospinal fluid barrier, was recently identified as an important component of the circadian clock system.

Objective:

The fact that circadian rhythm disruption is closely associated to Alzheimer’s disease (AD) led us to investigate whether AD pathology can contribute to disturbances of the circadian clock in the CP.

Methods:

For this purpose, we evaluated the expression of core-clock genes at different time points, in 6- and 12-month-old female and male APP/PS1 mouse models of AD. In addition, we also assessed the effect of melatonin pre-treatment in vitro before amyloid-β stimulus in the daily pattern of brain and muscle Arnt-like protein 1 (Bmal1) expression.

Results:

Our results showed a dysregulation of circadian rhythmicity of Bmal1 expression in female and male APP/PS1 transgenic 12-month-old mice and of Period 2 (Per2) expression in male mice. In addition, a significant circadian pattern of Bmal1 was measured the intermittent melatonin pre-treatment group, showing that melatonin can reset the CP circadian clock.

Conclusion:

These results demonstrated a connection between AD and the disruption of circadian rhythm in the CP, representing an attractive target for disease prevention and/or treatment.

INTRODUCTION

The choroid plexus (CP) is a highly vascularized structure, located in the cerebroventricular system, containing a single layer of cuboidal epithelial cells bound by tight junctions that form the blood-cerebrospinal fluid barrier (BCSFB) [1]. The best known role of the CP is the production and secretion of cerebrospinal fluid (CSF) [2]. In addition, the CP is involved in the supply of nutrients and hormones to the CSF and central nervous system, in the clearance of deleterious compounds and waste products from brain metabolism [3], neurogenesis [4], and amyloid clearance [5]. The CP is also a relevant target for multifunctional sex hormones [6]. Emerging functions reported for the CP include an important role in chemical surveillance [7– 9] and modulation of the circadian clock [10, 11], which is controlled by the light/dark cycle and sex steroid hormones [10]. We also found that the CP can produce melatonin [12], an indolamine hormone known to be closely implicated in the synchronization of circadian rhythms [13]. The CP is thus a crucial component and regulator of the circadian clock system [11].

The mammalian endogenous time-generating system is complex. It is composed of the master circadian clock located in the suprachiasmatic nucleus (SCN) and peripheral oscillators [14]. The molecular clock machinery consists of an autoregulatory positive and negative feedback transcriptional and translational network involving core-clock genes and their protein products [15, 16]. At the core of this network, the heterodimer complex formed of Clock (circadian locomotor output cycles protein kaput) and Bmal1 (brain and muscle Arnt-like protein 1), activates the transcription of the Period (Per1, Per2 and Per3), Cryptochrome (Cry1 and Cry2), Rev-Erb (Rev-Erba, Rev-Erbb), and Ror (Rora, Rorb, Rorc) genes. Interconnected transcription and translation feedback-loops subsequently generate oscillations in the expression of elements of the core-clock network, as well as their target genes [17, 18].

An increasing number of studies have reported that sex differences, aging, and age-related diseases promote alterations in the circadian oscillations of core-clock genes [19]. Particularly, Alzheimer’s disease (AD) is also accompanied by circadian disruption [20]. It is unclear to what extent circadian alterations contribute to AD pathogenesis, and changes occurring during the onset of the disease potentiate disruptions in normal rhythmic processes [21, 22]. It is well-documented that the most effective treatments for neurodegenerative diseases also modulate clock function [23]. Melatonin has been proposed as a co-adjuvant agent in the treatment and/or prevention of AD due to its chronobiotic/cytoprotective properties [24]. As a chronobiotic agent, melatonin treatment has the potential to improve circadian rhythmicity in AD patients (reviewed by [25]).

Initially it was thought that amyloid-β (Aβ) accumulated only in brain parenchyma and blood vessels. However, careful analysis also revealed an accumulation of Aβ in epithelial cells of the CP, probably as a consequence of CP dysfunction [26, 27]. In fact, AD pathology is associated with several morphological and functional alterations occurring in the BCSFB, such as epithelial cell atrophy, dysfunction of tight junctions, and calcification and thickening of the basement membrane. Such alterations in the structural integrity of epithelial cells can affect the CP’s ability to produce CSF, synthesize/secrete and transport several proteins or hormones, and clear toxic molecules such as Aβ species [26, 28].

Given the relevance of BCSFB, the investigation of the putative mechanistic link between AD and disturbances of the CP circadian clock may disclose an interesting target for disease prevention and treatment, through the restoration of the regular circadian rhythms. Thus, in the present study we explored the alterations in the expression of core-clock genes in the CP of an AD mouse model (APP/PS1) [29, 30], and evaluated the role of melatonin in the modulation of the CP circadian clock.

MATERIALS AND METHODS

Animal experiments

Female and male double transgenic amyloid precursor protein/presenilin-1 (APP/PS1) mice (6 and 12 months old), a cross between Tg2576 (overexpressing human APP695) and mutant PS1 (M146L) [29, 30], were used as a model of AD amyloidosis and bred at Instituto de Investigacion Hospital 12 de Octubre. Age and gender-matched wild-type (WT) mice not expressing the transgene were used as controls. Of note the control mice were littermates and were housed in the same cage as the APP/PS1 mice. All the animals were housed in appropriate cages at constant room temperature (between 20– 25°C), relative ambient humidity (between 50– 70%) under a 12 h light/12 h dark photoperiod, and standard laboratory conditions with chow and water ad libitum. For in vivo experiments, the 12 h light/dark cycle time points are referred as Zeitgeber Times, where ZT0 is when light is turned on (7 a.m.) and ZT12 when light is turned off (7 p.m.) and sampling times were defined according to ZTs. Female and male mice were deeply anaesthetized with 4% isoflurane, the CP were collected from both brain lateral ventricles at ZT1, ZT7, ZT13, and ZT19, and immediately snap frozen in liquid nitrogen. All the experiments were performed following the guidelines for animal care and use promulgated by the Council Directive 2010/63/UE of 22 September 2010.

Cell culture

Rat CP epithelium cells immortalized by stable transfection of a plasmid carrying the SV40 large T virus (Z310 cell line; gift from Dr. Wei Zheng - School of Health Sciences, Purdue University) were cultured in a complete culture medium of Dulbecco’s Modified Eagle Medium (DMEM; Gibco) supplemented with 10% heat-inactivated fetal bovine serum (v/v; Sigma-Aldrich) and 1% penicillin-streptomycin (v/v; Sigma-Aldrich) at 37°C with 5% CO2 in a humidified incubator [31].

Fig.1

Schematic diagram summarizing in vitro experimental procedures. Z310 cells (CP epithelial cell line) were initially synchronized for 2 h. After, cells were pre-treated with either vehicle control or melatonin during 3 cycles of 12 h: group I – 12 h+/12 h+/12 h+/12 h+; group II – 12 h+/12 h/12 h+/12 h; group III – 12 h/12 h+/12 h/12 h+; and group IV – 12 h/12 h/12 h/12 h. At the end of the melatonin pre-treatment cycles (3 cycles of 12 h, total of 36 h) Aβ1–42 was added to the different groups (group I and III in the presence of melatonin; group II and IV in the absence of melatonin). Cells were harvested 6 h after Aβ1–42 incubation and then at 6 h intervals throughout the 72 h period of the experiments

Schematic diagram summarizing in vitro experimental procedures. Z310 cells (CP epithelial cell line) were initially synchronized for 2 h. After, cells were pre-treated with either vehicle control or melatonin during 3 cycles of 12 h: group I – 12 h+/12 h+/12 h+/12 h+; group II – 12 h+/12 h–/12 h+/12 h–; group III – 12 h–/12 h+/12 h–/12 h+; and group IV – 12 h–/12 h–/12 h–/12 h–. At the end of the melatonin pre-treatment cycles (3 cycles of 12 h, total of 36 h) Aβ1–42 was added to the different groups (group I and III in the presence of melatonin; group II and IV in the absence of melatonin). Cells were harvested 6 h after Aβ1–42 incubation and then at 6 h intervals throughout the 72 h period of the experiments

In vitro experimental design

Z310 cells were seeded (1.5×104 cells/well) and grown on 24-well culture plates until 40– 50% confluence. The experiments were carried out 72 h after Z310 cells were seeded. Melatonin (Calbiochem) was prepared in 50% ethanol to obtain a 50 mM stock solution. Aβ1–42 (AnaSpec) was dissolved with 1% NH4OH to achieve an Aβ1–42 stock solution of 1 mg/mL. Z310 cells were initially synchronized with 100 nM of dexamethasone (Sigma-Aldrich) for 2 h. After, Z310 cells were treated with either vehicle control or 10 nM of melatonin during 3 cycles of 12 h. Melatonin was added continuously (group I: 12 h+/12 h+/12 h+/12 h+) or intermittently in order to mimic the light/dark cycle (group II: 12 h+/12 h/12 h+/12 h) and (group III: 12 h/12 h+/12 h/12 h+). A vehicle control group cultured in the absence of melatonin (group IV: 12 h/12 h/12 h/12 h) was included. After the melatonin pre-treatment cycles (36 h), the medium was changed and Aβ1–42 (3μg/mL) was added to the different groups (group I and III in the presence of melatonin; group II and IV in the absence of melatonin). The dose of Aβ was previously tested and enhanced a significant production of reactive oxygen species, although without inducing cell death in Z310 cell line [32]. Then, cells were harvested 6 h after Aβ1–42 incubation (Time (h)-6) and then at 6 h intervals throughout the 72 h period of the experiments (Fig. 1).

Table 1

Primers sequences used for RT-PCR and in quantitative real time RT-PCR for the Bmal1, Cry2, and Per2 mRNA expression in choroid plexus

GeneAccessionPrimers 5’- 3’ (Forward, Reverse)AmpliconReference
numbersize (bp)
mBmal1NM_007489GCAGTGCCACTGACTACCAAGA201Korencic 2014 [62]
TCCTGGACATTGCATTGCAT
mCry2NM_009963AGGGCTGCCAAGTGCATCAT151Korencic 2014 [62]
AGGAAGGGACAGATGCCAATAG
mPer2NM_011066CAACACAGACGACAGCATCA75Korencic 2014 [62]
TCCTGGTCCTTCAACAC
rBmal1NM_024362ACACTGCACCTCGGGAGCGA100Crew 2018 [63]
CGCCGAGCTCCAGAGCACAA
GapdhNM_001289726TCACCACCATGGAGAAGGC169Giulietti 2001 [64]
NM_017008GCTAAGCAGTTGGTGGTGCA

m, mouse; r, rat.

RT-PCR

Total RNA was isolated from mouse CP tissues and Z310 cell cultures using Trizol Reagent (Sigma-Aldrich) as per the manufacturer’s instructions. The isolated RNA was treated with AMPD1-1KT DNase I Kit (Sigma-Aldrich), accordingly to the manufacturer’s instructions. For assessing RNA quality, A260/280 ratio was analyzed and RNA concentration determined by spectrophotometry. RNA integrity was evaluated by 28S/18S rRNA visualization in agarose gel electrophoresis. cDNA was synthesized using NZY First-Strand cDNA synthesis kit (NZYTech Ltd.) according to the protocol supplied by the manufacturer. For the RT-PCR, cDNA was amplified by NZYTaq II 2× Green Master Mix (NZYTech Ltd.) and specific primers (Table 1) in a final volume of 25μL. The PCR protocols comprised a 30 s denaturation period at 95°C, 45 s at 58°C for in vivo and at 60°C for in vitro experiments, and 30 s extension at 72°C, for 40 cycles. Bmal1, Cry2, and Per2 amplified products were separated by electrophoresis on 1.5% agarose gels and visualized using Greensafe premium (NZYTech Ltd.) staining. In addition, PCR bands were purified and Sanger sequenced (Stabvida, Portugal) to confirm the sequence identity.

Real-time quantitative PCR

The analyses of the mRNA expression levels of Bmal1, Cry2, and Per2 with the reference gene Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) were performed by real-time RT-PCR using the CFX Connecttrademark Real-Time PCR Detection System (Bio-Rad). For in vivo experiments, the manufacturer’s instructions for the kit NZYSpeedy qPCR Green Master Mix (2×) (NZYTech Ltd.) were followed. Cycling conditions were: 95°C for 5 min, followed by 40 cycles of 95°C for 15 s, 58°C for 45 s, and 72°C for 10 s. The Xpert Fast SYBR (Uni) 2× Mastermix (GRiSP) was used for in vitro experiments. Real-time quantitative PCR gene-specific primers sequences are shown in Table 1. The analysis of the melting curve confirmed a single peak, corresponding to the expected amplification product. The ΔCt was calculated using Gapdh mRNA as the reference gene, and the ΔΔCt was calculated between the normalized ΔCt values from each time point and the average Ct value at all time points tested.

Fig.2

Expression profile of Bmal1 in mouse choroid plexus (CP). Harmonic regression analysis of Bmal1 mRNA level in the CP of 6- and 12-month-old female and male wild-type (WT; blue) and APP/PS1 (orange) mice. Mean±SEM (n≥3, except for male WT mice 12-month-old and APP/PS1 mice 6-month-old conditions at time point ZT13, n = 2). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 2

Expression profile of Bmal1 in mouse choroid plexus (CP). Harmonic regression analysis of Bmal1 mRNA level in the CP of 6- and 12-month-old female and male wild-type (WT; blue) and APP/PS1 (orange) mice. Mean±SEM (n≥3, except for male WT mice 12-month-old and APP/PS1 mice 6-month-old conditions at time point ZT13, n = 2). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 2

Statistical analysis

We tested the circadian behavior in the in vivo mRNA expression levels of Bmal1, Cry2, Per2, and in vitro mRNA expression levels of Bmal1 (under the conditions described in groups I– IV) by fitting a sine-cosine function to the time-course data using the R package Harmonic Regression [33]. We analyzed four (1 h to 19 h, with 6 h increments) and twelve time points (6 h to 72 h, with 6 h increments) for the in vivo and in vitro data, respectively. The harmonic regression procedure fits the model y(t) = m + acos(ωt) + bsin(ωt) to the time-course data in order to estimate the best fitting amplitudes (A =√(a2 + b2)) and phases (φ= atan2(b,a)) for a given period value [33]. We performed the harmonic regression tests for a 24 h period and reported the best fitting circadian parameters (amplitude and acrophase, i.e., time of the first peak) for significant oscillations. The significance of the harmonic regression was calculated with an F-test of the model fit. Oscillations were considered statistically significant for p < 0.05.

RESULTS

The rhythmicity of clock genes is disrupted in the CP of APP/PS1 mice

To study possible alterations in the CP circadian clock associated with AD pathology, we designed an experimental in vivo study to compare the circadian gene expression profile of CP core-clock genes in 6- and 12-month-old female and male APP/PS1 transgenic mice and non-transgenic WT littermates. Histological images from 6- and 12-month-old male mice tissues are provided in Supplementary Figure 1. We observed a reduced number of Aβ plaques in 6-month-old transgenic mice, while in 12-month-old animals there was higher concentration of amyloid deposits.

Bmal1 expression levels showed significant circadian oscillations in WT animals (Fig. 2; Table 2), with similar acrophases for all the groups centered on the onset of the dark phase (ZT = 13 to 15.3; Table 2). The oscillatory expression of Bmal1 was maintained in 6-month-old female and male APP/PS1 mice (Fig. 2; Table 2). However, in 12-month-old female and male APP/PS1 mice, the circadian rhythmicity of Bmal1 was lost (Fig. 2).

Table 2

Circadian parameters from the harmonic regression analysis with a 24 h period for in vivo Bmal1 gene expression in female and male mice choroid plexus (CP) under different conditions (Fig. 2). Circadian parameters are shown only for significant oscillations (p-value <0.05)

GenderAgeConditionpAmplitudeAcrophase
(months)(a.u.)(h)
Female6WT7.04×10–71.5213.70
APP/PS16.54×10–61.6413.01
12WT4.75×10–51.7115.31
APP/PS11.4×10–1
Male6WT5.21×10–41.4214.14
APP/PS16.48×10–62.0614.79
12WT1.88×10–21.1113.89
APP/PS18.2×10–2
Fig.3

Expression profile of Cry2 in mouse choroid plexus (CP). Harmonic regression analysis of Cry2 mRNA level in the CP of 6- and 12-month-old female and male wild-type (WT; blue) and APP/PS1 (orange) mice. Mean±SEM (n≥3, except for male WT mice 12-month-old condition at time ZT13, n = 2). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 3

Expression profile of Cry2 in mouse choroid plexus (CP). Harmonic regression analysis of Cry2 mRNA level in the CP of 6- and 12-month-old female and male wild-type (WT; blue) and APP/PS1 (orange) mice. Mean±SEM (n≥3, except for male WT mice 12-month-old condition at time ZT13, n = 2). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 3

Cry2 mRNA expression showed a significant circadian rhythm only for 6-month-old WT females (Fig. 3 and Table 3). In all the other WT and double transgenic mice groups, Cry2 mRNA expression lacked a significant circadian oscillation (Fig. 3).

Table 3

Circadian parameters from the harmonic regression analysis with a 24 h period for in vivo Cry2 gene expression in female and male mice choroid plexus (CP) under different conditions (Fig. 3). Circadian parameters are shown only for significant oscillations (p-value <0.05)

GenderAgeConditionpAmplitudeAcrophase
(months)(a.u.)(h)
Female6WT4.48×10–20.312.25
APP/PS15.90×10–1
12WT3.04×10–1
APP/PS19.63×10–1
Male6WT3.43×10–1
APP/PS13.01×10–1
12WT13.9×10–1
APP/PS16.97×10–1
Fig.4

Expression profile of Per2 in mouse choroid plexus (CP). Harmonic regression analysis of Per2 mRNA level in the CP of 6- and 12-month-old female and male wild-type (WT; blue) and APP/PS1 (orange) mice. Mean±SEM (n≥3, except for male WT mice 12-month-old condition at time ZT13, n = 2). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 4

Expression profile of Per2 in mouse choroid plexus (CP). Harmonic regression analysis of Per2 mRNA level in the CP of 6- and 12-month-old female and male wild-type (WT; blue) and APP/PS1 (orange) mice. Mean±SEM (n≥3, except for male WT mice 12-month-old condition at time ZT13, n = 2). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 4

Per2 mRNA expression levels presented significant 24 h rhythms in 6- and 12-month-old WT female mice (Fig. 4; Table 4). However, in WT male groups, the oscillation was only detected for 12-month-old mice (Fig. 4; Table 4). The peak of Per2 mRNA expression was in antiphase to Bmal1 mRNA, and occurred in the transition from dark to light (Table 4). Notably, a daily pattern of Per2 expression was conserved in 6- and 12-month-old female APP/PS1 mice (Fig. 4; Table 4). In addition, our analysis showed a 24 h period in the oscillations of Per2 expression in 6-month-old male APP/PS1 mice, but this rhythm was lost in 12-month-old male APP/PS1 mice (Fig. 4; Table 4).

Overall, in most cases, our data showed distinct daily patterns of Bmal1, Cry2, and Per2 expression in 6- and 12-month-old female and male WT and APP/PS1 animals, with Bmal1 and Cry2/Per2 oscillating in antiphase for some of the conditions analyzed, as previously reported for other tissues. Cry2 mRNA lost the circadian rhythmicity in 12-month-old WT females and daily variations of Bmal1 and Per2 were altered in 12-month-old APP/PS1 mice.

Melatonin modulates Bmal1 circadian parameters

The loss of rhythmicity found in female and male Bmal1 expression and in male Per2 mRNA expression in 12-month-old APP/PS1 mice prompted us to investigate if the disturbances of the circadian clock associated with AD could be minimized by melatonin treatment, a known AD-modulatory factor [34].

Table 4

Circadian parameters from the harmonic regressions with a 24 h period for in vivo Per 2 gene expression in female and male mice choroid plexus (CP) under different conditions (Fig. 4). Circadian parameters are shown only for significant oscillations (p-value <0.05)

GenderAgeConditionpAmplitudeAcrophase
(months)(a.u.)(h)
Female6WT1.08×10–41.142.42
APP/PS15.68×10–31.042.03
12WT6.89×10–31.021.31
APP/PS11.88×10–31.192.35
Male6WT5.67×10–2
APP/PS11.70×10–31.174.69
12WT3.52×10–21.161.12
APP/PS14.14×10–1

For that, we tested the circadian rhythmicity of Bmal1 in a CP cell line (Z310 cell line) pre-treated with melatonin in the presence of the Aβ peptide. Following the melatonin pre-treatment cycles (three cycles of 12 h), the medium was changed and Aβ1–42 was added to the different groups (group I and III in the presence of melatonin; group II and IV in the absence of melatonin; Fig. 1).

Fig.5

Circadian expression of Bmal1 after melatonin and Aβ treatment in vitro. Harmonic regression analysis for Bmal1 gene expression under the conditions of Group I– IV. Mean±SEM (n = 6). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 5.

Circadian expression of Bmal1 after melatonin and Aβ treatment in vitro. Harmonic regression analysis for Bmal1 gene expression under the conditions of Group I– IV. Mean±SEM (n = 6). Sine-cosine fits are shown for the significant 24 h period oscillations (p-value <0.05). The p-values and circadian parameters are shown in Table 5.

The Bmal1 gene only displayed a significant oscillatory behavior in the Z310 cell line pre-treated with intermittent melatonin (group III - medium with melatonin at the time of Aβ stimulus) (Fig. 5; Table 5). The non-significant oscillatory behavior was observed in the melatonin continuous pre-treatment group (group I), in the intermittent pre-treatment group in the absence of melatonin at the time of Aβ stimulus (group II) and in the untreated group (group IV) (Fig. 5).

DISCUSSION

Alterations in circadian rhythms are undisputable during healthy aging and in several age-related diseases. In AD, the circadian system is affected, with subsequent alterations in the circadian behavior and physiology. Circadian disturbances also favor disease progression and severity [35], illustrating the relevance of this bi-directional relationship. Considering the presence of a strong circadian clock in CP [10, 11] and the influence of this active interface in the initiation or progression of AD [28], disruption of CP circadian clock in AD should be taken into account as a potential cause and/or consequence of AD.

Table 5

Circadian parameters from the harmonic regressions with a 24 h period for in vitro Bmal1 gene expression under the conditions of Group I– IV (Fig. 5). Circadian parameters are shown only for significant oscillations (p-value <0.05)

GrouppAmplitude (a.u.)Acrophase (h)
I2.79×10–1
II7.42×10–1
III1.32×10–20.4221.25
IV2.28×10–1

Considering the relevance of the core-clock genes in the genesis of physiological circadian rhythms, it is of particular interest to examine a possible impact of healthy aging and AD on the circadian expression of the CP clock genes.

We found that most of the genes analyzed were rhythmically transcribed in the CP of WT female and male. This rhythmicity has been reported in former studies in the CP of female and male Wistar rats, aged 8– 10 weeks [10]. However, the current study only partially corroborates previous data, as we found distinct daily patterns in the CP of female and male WT mice for the clock genes analyzed. In fact, this is not particularly surprising if we consider that experiments were conducted in animal models of different nocturnal species and distinct age groups. The circadian clock establishes rhythms that are species-dependent and environmental parameters such as temperature, light, and humidity might also cause changes in the synchronization of the clock system [36]. Despite this idea, the factors that change the circadian patterns among different species have not been systematically explored. Furthermore, in recent years, it was shown that with increasing age, the circadian system experiences important alterations, which likely affect expression patterns of clock genes [37]. These might be two likely explanations for the differences observed in the expression pattern of circadian clock genes in rat and mice CP, reflecting an interaction of multiple variables that may affect clock gene expression changes. Despite the limited number of studies addressing aging effects in the expression of core-clock genes and the ambiguity of reported data, some studies showed age-related differences in mouse Per2 expression [38, 39] and more recently in Cry expression in the human prefrontal cortex [40]. In contrast, other studies documented no differences in Per2 SCN circadian expression between young and old animals [41]. The presence, in our study, of Per2 circadian rhythmicity in 12-month-old and not in 6-month-old WT males, supports a previous idea of a complex behavior of the Per2 circadian rhythmicity with aging. Overall, age-related changes were visible in females in a member of the negative loop, Cry2, while in other components of the negative loop, Per2 and Bmal1, rhythmic expression was preserved along aging.

The most remarkable result emerging from our data is the loss of Bmal1 circadian rhythmicity in both sexes and of Per2 in 12-month-old APP/PS1 male mice. In this animal model, an increase of Aβ levels accompanied by plaque deposits could be observed at 6 months of age, and was further aggravated at 10 months [42, 43]. These findings suggest that CP Bmal1 and Per2 oscillations are disrupted late in the AD process. Our results differ to some extent from other findings in the literature showing disruption of the clock genes in younger mouse models. Alterations in the oscillation patterns of Bmal1 and Per2 in the SCN of 5XFAB mice were described in 2-month-old animals [44]. Besides, disruption in the daily patterns of clock genes in the SCN, hippocampus, frontal cortex and brainstem, were observed in 6-month-old 3×Tg-AD mice and vanished by 18 months of age [45]. These differences in age-related effects in AD can be justified in part by the presence of high levels of Aβ in the CP of 12-month-old APP/PS1 mice [46]. The recent evidence of the contribution of Aβ deposits to the induction of circadian clock alterations in AD, at the molecular level, supports this hypothesis [47]. Another marked observation emerging from these data was the preservation of Per2 circadian rhythmicity in 12-month-old APP/PS1 female mice compared to male mice. This is in good agreement with previous results in which Per2 gene expression in the SCN of 6-month-old female 3×Tg-AD mice also retained circadian oscillation [48]. Moreover, a recent clinical study suggested that men are more vulnerable to circadian dysfunction than women, even in the preclinical phase of AD [49]. The protection of daily rhythms by estrogens was also demonstrated in Per2 liver circadian rhythmicity of high-fat feeding female mice [50]. Together these findings appear to support the concept of a protective effect of estrogens on the daily pattern of clock genes. Indeed, we have demonstrated that estrogens modulate Per2 circadian expression in rat CP [51].

Melatonin, a biological chronomodulator, is known to influence several levels of the circadian system, functioning as a synchronizer [13]. In fact, exogenous administration of melatonin increases circadian rhythm amplitudes and restores circadian oscillations [52]. Furthermore, a significant reduction in melatonin production with sequential effects in peripheral oscillators has been reported in aging and age-related neurodegenerative diseases, including AD [53]. In this context, it is possible that changes observed during AD, could be prevented or ameliorated through the regulation of the circadian rhythm by melatonin administration.

Following the detection of the dysregulation of the CP circadian clock genes in this AD mouse model, we examined the modulatory potential of melatonin in adjusting CP circadian rhythms. Hence, we investigated Bmal1 expression profile in a CP epithelial cell line pre-treated with melatonin in the presence of Aβ, a key element known to interfere with circadian dysfunction. The effect of Aβ on circadian rhythms might depend not only on the in vitro concentration used, but also on the structure and assembly of AD amyloid fibrils [47].

In the intermittent melatonin pre-treatment group (presence of melatonin in the medium at the time of Aβ stimulus, group III) we observed significant circadian oscillation in the expression of Bmal1, and this was the only scenario in which circadian rhythmicity was identified. In the literature, there are several examples highlighting the effects of melatonin on the expression of clock genes and circadian parameters [13]. Of particular interest is the in vitro modulation of Bmal1, which was reported to be upregulated in cultured adipocytes intermittently exposed to melatonin [54]. Moreover, in prostate cell cultures, melatonin was shown to down-regulate Bmal1, whereas in murine primary neuronal cultures Bmal1 mRNA levels were not altered [56]. Melatonin actions were also reflected in the recovery of the phase relationship between Bmal1 and Per2 in rat adrenal cultures [57]. Recently, it was shown that melatonin controls the expression of Bmal1 through PI3K/AKT signaling [58]. Thus, our results point to the relevance of the potential modulatory effect of melatonin in the circadian clock of CP epithelial cells, which are known to express melatonin receptors (MT1 and MT2) [59] and to be involved in the chronobiotic action of melatonin [60]. Future studies on the current topic are therefore required in order to elucidate if melatonin acts directly via MT1 and MT2.

The intermittent three cycles of 12 h of melatonin pre-exposure were conducted to simulate the physiological conditions of melatonin concentration in CSF, which rapidly increased after the onset of darkness and remained elevated during the night [61]. Thus, the adjustment of Bmal1 circadian expression in the presence of melatonin at the time of Aβ stimulus, points towards a modulatory role of melatonin in the CP circadian system. Together, these results support the hypothesis that the presence of melatonin at the time of Aβ stimulus and its cyclic pre-treatment promote the adjustment of Bmal1 circadian rhythmicity in CP epithelial cells. This study is the first step towards enhancing our understanding of melatonin contribution to the modulation of the Bmal1 circadian rhythmicity in the CP.

This research has raised new questions in need of further investigation and future work will focus on the mechanisms of melatonin action in the CP clock system and physiologic effects of melatonin in CP functions, namely in the important role of CP as a clearance route of Aβ

In summary, our results suggest that the CP molecular clock oscillation is altered during aging and that a dysregulation of the positive and negative feedback loops components occurs in late AD. Moreover, we underline the importance of melatonin as a modulator of CP molecular clock, highlighting its role as a potential chronobiotic agent in AD. We are confident that our results may improve knowledge about the involvement of melatonin in the maintenance of CP circadian clock and might be useful in clarifying the role of melatonin in AD pathogenesis.

ACKNOWLEDGMENTS

This work is supported by funds from the Health Sciences Research Center (CICS-UBI) through National Funds by FCT - Foundation for Science and Technology (UID/Multi/00709/2019). This work was partially supported by “Programa Operacional do Centro, Centro 2020” through the funding of the ICON project (Interdisciplinary Challenges on Neurodegeneration; CENTRO-01-0145-FEDER-000013)”. Work in the Relógio lab is funded by the German Federal Ministry of Education and Research (BMBF, grant no. 031A316) and by the Dr. Rolf M. Schwiete Stiftung. RA was additionally funded by the Berlin School of Integrative Oncology (BSIO). Work in the Eva Carro lab is supported by grants from the Instituto de Salud Carlos III (PI15/00780; PI18/00118), FEDER, CIBERNED (PI2016/01), and S2017/BMD-3700 (NEUROMETAB-CM) from Comunidad de Madrid co-financed with the Structural Funds of the European Union.

Authors’ disclosures available online (https://www.j-alz.com/manuscript-disclosures/20-0331r2).

SUPPLEMENTARY MATERIAL

REFERENCES

[1] 

Redzic ZB , Segal MB (2004) The structure of the choroid plexus and the physiology of the choroid plexus epithelium. Adv Drug Deliv Rev 56, 1695–1716.

[2] 

Damkier HH , Brown PD , Praetorius J (2013) Cerebrospinal fluid secretion by the choroid plexus. Physiol Rev 93, 1847–1892.

[3] 

Spector R , Keep RF , Robert Snodgrass S , Smith QR , Johanson CE (2015) A balanced view of choroid plexus structure and function: Focus on adult humans. Exp Neurol 267, 78–86.

[4] 

Lun MP , Monuki ES , Lehtinen MK (2015) Development and functions of the choroid plexus-cerebrospinal fluid system. Nat Rev Neurosci 16, 445–457.

[5] 

Pascale CL , Miller MC , Chiu C , Boylan M , Caralopoulos IN , Gonzalez L , Johanson CE , Silverberg GD (2011) Amyloid-beta transporter expression at the blood-CSF barrier is age-dependent. Fluids Barriers CNS 8, 21.

[6] 

Santos CR , Duarte AC , Quintela T , Tomas J , Albuquerque T , Marques F , Palha JA , Goncalves I (2017) The choroid plexus as a sex hormone target: Functional implications. Front Neuroendocrinol 44, 103–121.

[7] 

Goncalves I , Hubbard PC , Tomas J , Quintela T , Tavares G , Caria S , Barreiros D , Santos CR (2016) ‘Smelling’ the cerebrospinal fluid: Olfactory signaling molecules are expressed in and mediate chemosensory signaling from the choroid plexus. FEBS J 283, 1748–1766.

[8] 

Tomas J , Santos CR , Quintela T , Goncalves I (2016) “Tasting” the cerebrospinal fluid: Another function of the choroid plexus? Neuroscience 320, 160–171.

[9] 

Tomas J , Santos CRA , Duarte AC , Maltez M , Quintela T , Lemos MC , Goncalves I (2019) Bitter taste signaling mediated by Tas2r144 is down-regulated by 17beta-estradiol and progesterone in the rat choroid plexus. Mol Cell Endocrinol 495, 110521.

[10] 

Quintela T , Sousa C , Patriarca FM , Goncalves I , Santos CR (2015) Gender associated circadian oscillations of the clock genes in rat choroid plexus. Brain Struct Funct 220, 1251–1262.

[11] 

Myung J , Schmal C , Hong S , Tsukizawa Y , Rose P , Zhang Y , Holtzman MJ , De Schutter E , Herzel H , Bordyugov G , Takumi T (2018) The choroid plexus is an important circadian clock component. Nat Commun 9, 1062.

[12] 

Quintela T , Goncalves I , Silva M , Duarte AC , Guedes P , Andrade K , Freitas F , Talhada D , Albuquerque T , Tavares S , Passarinha LA , Cipolla-Neto J , Santos CRA (2018) Choroid plexus is an additional source of melatonin in the brain. J Pineal Res 65, e12528.

[13] 

Hardeland R , Madrid JA , Tan DX , Reiter RJ (2012) Melatonin, the circadian multioscillator system and health: The need for detailed analyses of peripheral melatonin signaling. J Pineal Res 52, 139–166.

[14] 

Reppert SM , Weaver DR (2001) Molecular analysis of mammalian circadian rhythms. Annu Rev Physiol 63, 647–676.

[15] 

Hastings MH , Brancaccio M , Maywood ES (2014) Circadian pacemaking in cells and circuits of the suprachiasmatic nucleus. J Neuroendocrinol 26, 2–10.

[16] 

Fuhr L , Abreu M , Pett P , Relogio A (2015) Circadian systems biology: When time matters. Comput Struct Biotechnol J 13, 417–426.

[17] 

Mohawk JA , Green CB , Takahashi JS (2012) Central and peripheral circadian clocks in mammals. Ann Rev Neurosci 35, 445–462.

[18] 

El-Athman R , Genov NN , Mazuch J , Zhang K , Yu Y , Fuhr L , Abreu M , Li Y , Wallach T , Kramer A , Schmitt CA , Relogio A (2017) The Ink4a/Arf locus operates as a regulator of the circadian clock modulating RAS activity. PLoS Biol 15, e2002940.

[19] 

Mong JA , Baker FC , Mahoney MM , Paul KN , Schwartz MD , Semba K , Silver R (2011) Sleep, rhythms, and the endocrine brain: Influence of sex and gonadal hormones. J Neurosci 31, 16107–16116.

[20] 

Musiek ES , Xiong DD , Holtzman DM (2015) Sleep, circadian rhythms, and the pathogenesis of Alzheimer disease. Exp Mol Med 47, e148.

[21] 

Homolak J , Mudrovcic M , Vukic B , Toljan K (2018) Circadian rhythm and Alzheimer’s disease. Med Sci (Basel) 6, 52.

[22] 

Musiek ES (2017) Circadian rhythms in AD pathogenesis: A critical appraisal. Curr Sleep Med Rep 3, 85–92.

[23] 

Logan RW , McClung CA (2019) Rhythms of life: Circadian disruption and brain disorders across the lifespan. Nat Rev Neurosci 20, 49–65.

[24] 

Cardinali DP , Vigo DE , Olivar N , Vidal MF , Brusco LI (2014) Melatonin therapy in patients with Alzheimer’s disease. Antioxidants (Basel) 3, 245–277.

[25] 

Lin L , Huang QX , Yang SS , Chu J , Wang JZ , Tian Q (2013) Melatonin in Alzheimer’s disease. Int J Mol Sci 14, 14575–14593.

[26] 

Krzyzanowska A , Carro E (2012) Pathological alteration in the choroid plexus of Alzheimer’s disease: Implication for new therapy approaches. Front Pharmacol 3, 75.

[27] 

Dietrich MO , Spuch C , Antequera D , Rodal I , de Yebenes JG , Molina JA , Bermejo F , Carro E (2008) Megalin mediates the transport of leptin across the blood-CSF barrier. Neurobiol Aging 29, 902–912.

[28] 

Balusu S , Brkic M , Libert C , Vandenbroucke RE (2016) The choroid plexus-cerebrospinal fluid interface in Alzheimer’s disease: More than just a barrier. Neural Regen Res 11, 534–537.

[29] 

Holcomb L , Gordon MN , McGowan E , Yu X , Benkovic S , Jantzen P , Wright K , Saad I , Mueller R , Morgan D , Sanders S , Zehr C , O’Campo K , Hardy J , Prada CM , Eckman C , Younkin S , Hsiao K , Duff K (1998) Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes. Nat Med 4, 97–100.

[30] 

Gordon MN , Holcomb LA , Jantzen PT , DiCarlo G , Wilcock D , Boyett KW , Connor K , Melachrino J , O’Callaghan JP , Morgan D (2002) Time course of the development of Alzheimer-like pathology in the doubly transgenic PS1+APP mouse. Exp Neurol 173, 183–195.

[31] 

Zheng W , Zhao Q (2002) Establishment and characterization of an immortalized Z310 choroidal epithelial cell line from murine choroid plexus. Brain Res 958, 371–380.

[32] 

Costa AR , Marcelino H , Goncalves I , Quintela T , Tomas J , Duarte AC , Fonseca AM , Santos CR (2016) Sex hormones protect against amyloid-beta induced oxidative stress in the choroid plexus cell line Z310. J Neuroendocrinol 28, doi: 10.1111/jne.12404.

[33] 

Luck S , Thurley K , Thaben PF , Westermark PO (2014) Rhythmic degradation explains and unifies circadian transcriptome and proteome data. Cell Rep 9, 741–751.

[34] 

Vincent B (2018) Protective roles of melatonin against the amyloid-dependent development of Alzheimer’s disease: A critical review. Pharmacol Res 134, 223–237.

[35] 

Saeed Y , Abbott SM (2017) Circadian disruption associated with Alzheimer’s disease. Curr Neurol Neurosci Rep 17, 29.

[36] 

Yan L , Smale L , Nunez AA (2020) Circadian and photic modulation of daily rhythms in diurnal mammals. Eur J Neurosci 51, 551–566.

[37] 

Hood S , Amir S (2017) The aging clock: Circadian rhythms and later life. J Clin Invest 127, 437–446.

[38] 

Bonaconsa M , Malpeli G , Montaruli A , Carandente F , Grassi-Zucconi G , Bentivoglio M (2014) Differential modulation of clock gene expression in the suprachiasmatic nucleus, liver and heart of aged mice. Exp Gerontol 55, 70–79.

[39] 

Weinert H , Weinert D , Schurov I , Maywood ES , Hastings MH (2001) Impaired expression of the mPer2 circadian clock gene in the suprachiasmatic nuclei of aging mice. Chronobiol Int 18, 559–565.

[40] 

Chen CY , Logan RW , Ma T , Lewis DA , Tseng GC , Sibille E , McClung CA (2016) Effects of aging on circadian patterns of gene expression in the human prefrontal cortex. Proc Natl Acad Sci U S A 113, 206–211.

[41] 

Asai M , Yoshinobu Y , Kaneko S , Mori A , Nikaido T , Moriya T , Akiyama M , Shibata S (2001) Circadian profile of Per gene mRNA expression in the suprachiasmatic nucleus, paraventricular nucleus, and pineal body of aged rats. J Neurosci Res 66, 1133–1139.

[42] 

Jankowsky JL , Fadale DJ , Anderson J , Xu GM , Gonzales V , Jenkins NA , Copeland NG , Lee MK , Younkin LH , Wagner SL , Younkin SG , Borchelt DR (2004) Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide: Evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet 13, 159–170.

[43] 

Perez SE , Lazarov O , Koprich JB , Chen EY , Rodriguez-Menendez V , Lipton JW , Sisodia SS , Mufson EJ (2005) Nigrostriatal dysfunction in familial Alzheimer’s disease-linked APPswe/PS1DeltaE9 transgenic mice. J Neurosci 25, 10220–10229.

[44] 

Song H , Moon M , Choe HK , Han DH , Jang C , Kim A , Cho S , Kim K , Mook-Jung I (2015) Abeta-induced degradation of BMAL1 and CBP leads to circadian rhythm disruption in Alzheimer’s disease. Mol Neurodegener 10, 13.

[45] 

Bellanti F , Iannelli G , Blonda M , Tamborra R , Villani R , Romano A , Calcagnini S , Mazzoccoli G , Vinciguerra M , Gaetani S , Giudetti AM , Vendemiale G , Cassano T , Serviddio G (2017) Alterations of clock gene RNA expression in brain regions of a triple transgenic model of Alzheimer’s disease. J Alzheimers Dis 59, 615–631.

[46] 

Vargas T , Ugalde C , Spuch C , Antequera D , Moran MJ , Martin MA , Ferrer I , Bermejo-Pareja F , Carro E (2010) Abeta accumulation in choroid plexus is associated with mitochondrial-induced apoptosis. Neurobiol Aging 31, 1569–1581.

[47] 

Schmitt K , Grimm A , Eckert A (2017) Amyloid-beta-induced changes in molecular clock properties and cellular bioenergetics. Front Neurosci 11, 124.

[48] 

Wu M , Zhou F , Cao X , Yang J , Bai Y , Yan X , Cao J , Qi J (2018) Abnormal circadian locomotor rhythms and Per gene expression in six-month-old triple transgenic mice model of Alzheimer’s disease. Neurosci Lett 676, 13–18.

[49] 

Musiek ES , Bhimasani M , Zangrilli MA , Morris JC , Holtzman DM , Ju YS (2018) Circadian rest-activity pattern changes in aging and preclinical Alzheimer disease. JAMA Neurol 75, 582–590.

[50] 

Palmisano BT , Stafford JM , Pendergast JS (2017) High-fat feeding does not disrupt daily rhythms in female mice because of protection by ovarian hormones. Front Endocrinol (Lausanne) 8, 44.

[51] 

Quintela T , Albuquerque T , Lundkvist G , Carmine Belin A , Talhada D , Goncalves I , Carro E , Santos CRA (2017) The choroid plexus harbors a circadian oscillator modulated by estrogens. Chronobiol Int 35, 270–279.

[52] 

Zisapel N (2018) New perspectives on the role of melatonin in human sleep, circadian rhythms and their regulation. Br J Pharmacol 175, 3190–3199.

[53] 

Majidinia M , Reiter RJ , Shakouri SK , Yousefi B (2018) The role of melatonin, a multitasking molecule, in retarding the processes of ageing. Ageing Res Rev 47, 198–213.

[54] 

Alonso-Vale MI , Andreotti S , Mukai PY , Borges-Silva C , Peres SB , Cipolla-Neto J , Lima FB (2008) Melatonin and the circadian entrainment of metabolic and hormonal activities in primary isolated adipocytes. J Pineal Res 45, 422–429.

[55] 

Jung-Hynes B , Huang W , Reiter RJ , Ahmad N (2010) Melatonin resynchronizes dysregulated circadian rhythm circuitry in human prostate cancer cells. J Pineal Res 49, 60–68.

[56] 

Imbesi M , Arslan AD , Yildiz S , Sharma R , Gavin D , Tun N , Manev H , Uz T (2009) The melatonin receptor MT1 is required for the differential regulatory actions of melatonin on neuronal ‘clock’ gene expression in striatal neurons. }. J Pineal Res 46, 87–94.

[57] 

Torres-Farfan C , Mendez N , Abarzua-Catalan L , Vilches N , Valenzuela GJ , Seron-Ferre M (2011) A circadian clock entrained by melatonin is ticking in the rat fetal adrenal. Endocrinology 152, 1891–1900.

[58] 

Beker MC , Caglayan B , Caglayan AB , Kelestemur T , Yalcin E , Caglayan A , Kilic U , Baykal AT , Reiter RJ , Kilic E (2019) Interaction of melatonin and Bmal1 in the regulation of PI3K/AKT pathway components and cellular survival. Sci Rep 9, 19082.

[59] 

Hardeland R (2009) Melatonin: Signaling mechanisms of aleiotropic agent. Biofactors 35, 183–192.

[60] 

Cardinali DP (2019) Melatonin: Clinicalerspectives in neurodegeneration. Front Endocrinol (Lausanne) 10, 480.

[61] 

Reiter RJ , Tan DX , Kim SJ , Cruz MH (2014) Delivery of pineal melatonin to the brain and SCN: Role of canaliculi, cerebrospinal fluid, tanycytes and Virchow-Robin perivascular spaces. Brain Struct Funct 219, 1873–1887.

[62] 

Korencic A , Kosir R , Bordyugov G , Lehmann R , Rozman D , Herzel H (2014) Timing of circadian genes in mammalian tissues. Sci Rep 4, 5782.

[63] 

Crew RC , Waddell BJ , Mark PJ (2018) Obesity-induced changes in hepatic and placental clock gene networks in rat pregnancy. Biol Reprod 98, 75–88.

[64] 

Giulietti A , Overbergh L , Valckx D , Decallonne B , Bouillon R , Mathieu C (2001) An overview of real-time quantitative PCR: Applications to quantify cytokine gene expression. Methods 25, 386–401.